smallRNA plugin configuration

The configuration options for the smallRNA plugin are described in the following table.

Setting	Description
microRNA reference	mirbase (build 20) – Use to align against a mirBase reference, constructed from the mirBase GFF file with 10 bp padding. genome – Use to align against the whole genome.
Rescue reference	hg19
Adapter Sequence	This setting allows you to select the adapter sequence that you want to trim from the 3' end of the reads. TGGAATTCTCGGGTGCCAAGGATCACCGACTGCCCATAGAGAGGCTGAGAC – The adapter sequence for the TriLink small RNA Barcode Set. This is the default setting. ATCACCGACTGCCCATAGAG – The adapter sequence for the IonXpressRNA barcode set. (none) – No adapter sequence is trimmed from the reads.
Minimum adaptor overlap	Specifies the minimum length of sequence at the 3' end of the read that must match the adapter sequence for identification and trimming. The default value is 5. Do not change the default setting unless you understand how the change can affect the sequencing data.
Minimum read length	Reads that are shorter than the specified length are filtered out regardless of the adapter sequence. The default value is 15. Do not change the default setting unless you understand how the change can affect the sequencing data.